Review





Similar Products

96
ATCC odn 2007 class b cpg oligonucleotide
Odn 2007 Class B Cpg Oligonucleotide, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/odn 2007 class b cpg oligonucleotide/product/ATCC
Average 96 stars, based on 1 article reviews
odn 2007 class b cpg oligonucleotide - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

93
InvivoGen synthetic class b 2007 cpg oligodeoxynucleotide odn
Synthetic Class B 2007 Cpg Oligodeoxynucleotide Odn, supplied by InvivoGen, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthetic class b 2007 cpg oligodeoxynucleotide odn/product/InvivoGen
Average 93 stars, based on 1 article reviews
synthetic class b 2007 cpg oligodeoxynucleotide odn - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Millipore synthetic class b cpg odn 2007
Synthetic Class B Cpg Odn 2007, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthetic class b cpg odn 2007/product/Millipore
Average 90 stars, based on 1 article reviews
synthetic class b cpg odn 2007 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
InvivoGen odn 2007 class b cpg oligonucleotide
Odn 2007 Class B Cpg Oligonucleotide, supplied by InvivoGen, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/odn 2007 class b cpg oligonucleotide/product/InvivoGen
Average 93 stars, based on 1 article reviews
odn 2007 class b cpg oligonucleotide - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
InvivoGen synthetic class b 2007 cpg odn
Experimental design for the first trial.
Synthetic Class B 2007 Cpg Odn, supplied by InvivoGen, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthetic class b 2007 cpg odn/product/InvivoGen
Average 93 stars, based on 1 article reviews
synthetic class b 2007 cpg odn - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
InvivoGen odn 2007 class b cpg oligonucleotide 5 tcgtcgttgtcgttttgtcgtt
Experimental design for the first trial.
Odn 2007 Class B Cpg Oligonucleotide 5 Tcgtcgttgtcgttttgtcgtt, supplied by InvivoGen, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/odn 2007 class b cpg oligonucleotide 5 tcgtcgttgtcgttttgtcgtt/product/InvivoGen
Average 93 stars, based on 1 article reviews
odn 2007 class b cpg oligonucleotide 5 tcgtcgttgtcgttttgtcgtt - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
InvivoGen synthetic class b cpg odn 2007
Experimental design for the first trial.
Synthetic Class B Cpg Odn 2007, supplied by InvivoGen, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthetic class b cpg odn 2007/product/InvivoGen
Average 93 stars, based on 1 article reviews
synthetic class b cpg odn 2007 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
InvivoGen synthetic class b cpg oligodeoxynucleotides 2007
Experimental design for the first trial.
Synthetic Class B Cpg Oligodeoxynucleotides 2007, supplied by InvivoGen, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthetic class b cpg oligodeoxynucleotides 2007/product/InvivoGen
Average 93 stars, based on 1 article reviews
synthetic class b cpg oligodeoxynucleotides 2007 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


Experimental design for the first trial.

Journal: Vaccines

Article Title: Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens

doi: 10.3390/vaccines12080908

Figure Lengend Snippet: Experimental design for the first trial.

Article Snippet: A phosphorothioate-based synthetic class B 2007 CpG ODN, purchased from Invivogen (San Diego, CA, USA), was reconstituted in endotoxin-free water and diluted to working quantities in PBS.

Techniques:

Illustration of first experimental design. On embryonic day 18, 136 eggs were randomly divided into four groups (G1–G4), each containing 34 eggs. Embryos of each group were injected intra-amniotic with the assigned immunization: 50 µg CpG ODN or 125 µg C. jejuni OMPs or their combination or PBS (negative control group). On the first day post-hatch, chicks (136) of non-immunized eggs were randomly allocated into four groups (G5–G8) and immunized SC with 50 µg CpG ODN or 125 µg C. jejuni OMPs or their combination or PBS. All chicks received the booster vaccination on day seven, and all groups were challenged with 10 7 CFUs of C. jejuni on day 14. Bursa of Fabricius and spleens were collected for three successive days ( n = 8) post-initial vaccination of either SC or in ovo immunized groups. Blood samples were collected weekly, and the cecal contents were collected on day 35 of age (the end of the experiment).

Journal: Vaccines

Article Title: Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens

doi: 10.3390/vaccines12080908

Figure Lengend Snippet: Illustration of first experimental design. On embryonic day 18, 136 eggs were randomly divided into four groups (G1–G4), each containing 34 eggs. Embryos of each group were injected intra-amniotic with the assigned immunization: 50 µg CpG ODN or 125 µg C. jejuni OMPs or their combination or PBS (negative control group). On the first day post-hatch, chicks (136) of non-immunized eggs were randomly allocated into four groups (G5–G8) and immunized SC with 50 µg CpG ODN or 125 µg C. jejuni OMPs or their combination or PBS. All chicks received the booster vaccination on day seven, and all groups were challenged with 10 7 CFUs of C. jejuni on day 14. Bursa of Fabricius and spleens were collected for three successive days ( n = 8) post-initial vaccination of either SC or in ovo immunized groups. Blood samples were collected weekly, and the cecal contents were collected on day 35 of age (the end of the experiment).

Article Snippet: A phosphorothioate-based synthetic class B 2007 CpG ODN, purchased from Invivogen (San Diego, CA, USA), was reconstituted in endotoxin-free water and diluted to working quantities in PBS.

Techniques: Injection, Negative Control, In Ovo

Serum IgY antibody levels. Chicks were immunized in ovo or SC with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. A booster dose was delivered orally (for those primed in ovo) or SC (for those primed SC) on day seven of age. All the chicks were then orally challenged with 10 7 CFUs of C. jejuni on day 14 of age. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgY antibody (Ab) levels using ELISA. Bars marked with different letters (a–b) indicate significant differences ( p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.

Journal: Vaccines

Article Title: Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens

doi: 10.3390/vaccines12080908

Figure Lengend Snippet: Serum IgY antibody levels. Chicks were immunized in ovo or SC with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. A booster dose was delivered orally (for those primed in ovo) or SC (for those primed SC) on day seven of age. All the chicks were then orally challenged with 10 7 CFUs of C. jejuni on day 14 of age. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgY antibody (Ab) levels using ELISA. Bars marked with different letters (a–b) indicate significant differences ( p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.

Article Snippet: A phosphorothioate-based synthetic class B 2007 CpG ODN, purchased from Invivogen (San Diego, CA, USA), was reconstituted in endotoxin-free water and diluted to working quantities in PBS.

Techniques: In Ovo, Enzyme-linked Immunosorbent Assay, Membrane

The correlation between C. jejuni CFUs and serum antibody (Ab) levels using Pearson’s r correlation coefficient. No correlation was observed between the serum IgY Ab levels and cecal counts of C. jejuni in the group immunized SC with the combination of 50 µg CpG ODN and 125 µg OMPs at the fifth week of age.

Journal: Vaccines

Article Title: Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens

doi: 10.3390/vaccines12080908

Figure Lengend Snippet: The correlation between C. jejuni CFUs and serum antibody (Ab) levels using Pearson’s r correlation coefficient. No correlation was observed between the serum IgY Ab levels and cecal counts of C. jejuni in the group immunized SC with the combination of 50 µg CpG ODN and 125 µg OMPs at the fifth week of age.

Article Snippet: A phosphorothioate-based synthetic class B 2007 CpG ODN, purchased from Invivogen (San Diego, CA, USA), was reconstituted in endotoxin-free water and diluted to working quantities in PBS.

Techniques:

Serum IgM antibody levels. Chicks were immunized in ovo or SC with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. A booster dose was delivered orally (for those primed in ovo) or SC (for those primed SC) on day seven of age. All the chicks were then orally challenged with 10 7 CFUs of C. jejuni on day 14 of age. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgM antibody (Ab) levels using ELISA. Bars marked with different letters (a–c) indicate significant differences ( p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.

Journal: Vaccines

Article Title: Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens

doi: 10.3390/vaccines12080908

Figure Lengend Snippet: Serum IgM antibody levels. Chicks were immunized in ovo or SC with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. A booster dose was delivered orally (for those primed in ovo) or SC (for those primed SC) on day seven of age. All the chicks were then orally challenged with 10 7 CFUs of C. jejuni on day 14 of age. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgM antibody (Ab) levels using ELISA. Bars marked with different letters (a–c) indicate significant differences ( p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.

Article Snippet: A phosphorothioate-based synthetic class B 2007 CpG ODN, purchased from Invivogen (San Diego, CA, USA), was reconstituted in endotoxin-free water and diluted to working quantities in PBS.

Techniques: In Ovo, Enzyme-linked Immunosorbent Assay, Membrane

The correlation between C. jejuni CFUs and serum antibody (Ab) levels using Pearson’s r correlation coefficient. No correlation was observed between the serum IgM Ab levels and cecal counts of C. jejuni in the group immunized with the combination of 50 µg CpG ODN and 125 µg OMPs at the fifth week of age.

Journal: Vaccines

Article Title: Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens

doi: 10.3390/vaccines12080908

Figure Lengend Snippet: The correlation between C. jejuni CFUs and serum antibody (Ab) levels using Pearson’s r correlation coefficient. No correlation was observed between the serum IgM Ab levels and cecal counts of C. jejuni in the group immunized with the combination of 50 µg CpG ODN and 125 µg OMPs at the fifth week of age.

Article Snippet: A phosphorothioate-based synthetic class B 2007 CpG ODN, purchased from Invivogen (San Diego, CA, USA), was reconstituted in endotoxin-free water and diluted to working quantities in PBS.

Techniques:

Relative gene expression of interferon (IFN)-γ ( a ), interleukin (IL)-13 ( b ), and IL-1β ( c ) in the spleen at 24, 48, and 72 h following SC immunization with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. Data are presented as mean expression (delta CT values) of cytokine mRNA relative to β-actin (housekeeping gene) ± standard error of the mean (SEM). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey’s comparison test. Bars marked with different letters ( a , b ) indicate significant differences ( p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneously. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.

Journal: Vaccines

Article Title: Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens

doi: 10.3390/vaccines12080908

Figure Lengend Snippet: Relative gene expression of interferon (IFN)-γ ( a ), interleukin (IL)-13 ( b ), and IL-1β ( c ) in the spleen at 24, 48, and 72 h following SC immunization with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. Data are presented as mean expression (delta CT values) of cytokine mRNA relative to β-actin (housekeeping gene) ± standard error of the mean (SEM). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey’s comparison test. Bars marked with different letters ( a , b ) indicate significant differences ( p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneously. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.

Article Snippet: A phosphorothioate-based synthetic class B 2007 CpG ODN, purchased from Invivogen (San Diego, CA, USA), was reconstituted in endotoxin-free water and diluted to working quantities in PBS.

Techniques: Expressing, Comparison, Membrane

Relative gene expression of interferon (IFN)-γ ( a ), interleukin (IL)-13 ( b ), and IL-1β ( c ) in the spleen at 24, 48, and 72 h following in ovo immunization with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. Data are presented as mean expression (delta CT values) of cytokine mRNA relative to β-actin (housekeeping gene) ± standard error of the mean (SEM). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey’s comparison test. Bars marked with different letters ( a , b ) indicate significant differences ( p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneously. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.

Journal: Vaccines

Article Title: Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens

doi: 10.3390/vaccines12080908

Figure Lengend Snippet: Relative gene expression of interferon (IFN)-γ ( a ), interleukin (IL)-13 ( b ), and IL-1β ( c ) in the spleen at 24, 48, and 72 h following in ovo immunization with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. Data are presented as mean expression (delta CT values) of cytokine mRNA relative to β-actin (housekeeping gene) ± standard error of the mean (SEM). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey’s comparison test. Bars marked with different letters ( a , b ) indicate significant differences ( p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneously. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.

Article Snippet: A phosphorothioate-based synthetic class B 2007 CpG ODN, purchased from Invivogen (San Diego, CA, USA), was reconstituted in endotoxin-free water and diluted to working quantities in PBS.

Techniques: Expressing, In Ovo, Comparison, Membrane